For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chrX:7903411+7903549 139bp TGAGCAACCTCACTCTGAGAA AGCAAGGCTCAGGGTTCGT |
Mutant= 149 bp
Wild Type = 139 bp
Sequence
Wt Sequence (deletions in lower case):
TGAGCAACCTCACTCTGAGAATATCTCTGTTGGATTTTCTCTCCATCCTCctggttctttggctgctgctctgcatctagtagctttcccatgccttctttgttgcagtgctgggcatagacgaaccctgagccttgctcattatggacacatgctctaccactgaggaccccagcaccccttcctttttataaagcctgcaaccctgcctgccagtgagtgctcttacccctcctctaacacctctccttgctttctccagggaattcgacaccggttcagaggtagtgtcaatgctgtgaggatccgggcaccccagattggaggtgagatcgtggaaccataaagatgtgttaggaactttaagggtaattgatcctttgaaactagactgtaagttataggtccagattctaactcaaagtctgactgcaacttccccacagtctaatatgaaagggcacGAATACGTATTGCGGTTGATTTGTTTTTGAGACAGGGTCTCTCTGTATAGCCTTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTACCCTCACAGAG
This mutation is a 414 bp deletion beginning at Chromosome X position 7,903,461 bp and ending after 7,903,874 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 63487 | TGA GCA ACC TCA CTC TGA GAA | Common | A | |||
| 63489 | AGC AAG GCT CAG GGT TCG T | Wild type Reverse | A | |||
| 63490 | CTC TGT GAG GGT AGC CTG GT | Mutant Reverse | A | |||
| 63491 | Fluorophore-1 | CTC CAT CCT CCT GGT TCT TTG | Quencher-1 | WT Probe | ||
| 63492 | Fluorophore-2 | TCT CTC CAT CCT CGA ATA CGT ATT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 63487 | 0.40 uM |
| 63489 | 0.40 uM |
| 63490 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.