For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:5160196-5160313 118bp TGGGCAGATAACAGAGAAAATG TGGTTGTAAGAGTGATTGGTCAG
Mutant= 123 bp
Wild Type = 118 bp
Sequence
Wt Sequence:
ggtccacccttctcccttcatccctcttagaacatctctttcgtcataatcctggtgactgtgttgaatcacatagagaaaacatctgggcagataacagagaaaatgatgtttctaagcttatgtagacctaccagcaccctgcagtaccaggccctctggcatttctttctttctttctctgaccaatcactcttacaaccaagagacgctaaagccactaacactcagtcctctagc
Mutant Sequence:
aaaatgaatgcaattgttgttgttaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggatccccatcaagctgatccggaacccttaatataacttcgtatagcatacattatacgaagttatTCTGGCATTTCTTTCTTTCTTTCTCTGACCAATCACTCTTACAACCAAGAGACGCTAAAGCCACTAACACTCAGTCCTCTAGCTGGACCTGAACCACCAAGGTTCTGGTTGCT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 25183 | ATC ATG TCT GGA TCC CCA TC | Mutant Forward | A | |||
| 51677 | Fluorophore-1 | AAG CTG ATC CGG AAC CCT TAA | Quencher-1 | MUT Probe | ||
| 63392 | TGG GCA GAT AAC AGA GAA AAT G | Wild type Forward | A | |||
| 63393 | TGG TTG TAA GAG TGA TTG GTC AG | Common | A | |||
| 63394 | Fluorophore-2 | CCA GCA CCC TGC AGT ACC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 25183 | 0.40 uM |
| 63392 | 0.40 uM |
| 63393 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.