For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:62883835+62883962 128bp CAGGACAGCATTGTGGATTG TGATATTTGTAGCTTGGCACAG |
Mutant= 118 bp
Wild Type = 128 bp
Sequence
Wt Sequence (deletion in lower case):
GGTGGGCACTTGAGGGTAAGCTGCTGGCTTCCTCCTCCCCTTATCTCATGGTTGTGGGTTGCTGGCTCTTGCAGTGAAGtgtaacggagctgctgtgccttgcttttaggcaccccgtggcatccttcttccatctgttcttccgggtcagtgcggttgtggtctatctcctttgcgagctgctcagtagcagctttatcgcctgcatggtgacaattatcttgctgctgtcatgcgacttttgggcagtaaaggtaggttctgtttctattttaaaactgtatttaatatgaattcaaataacgaattgaaaggaacaggacagcattgtggattgatgttagttcattcattactttagaccttctgtgtgttgaagtgccaggcacaccgttcacataaacacTGCTCAGTTGTGGTGCCCTGTGCCAAGCTACAAATATCA
This mutation is a 327 bp deletion beginning at Chromosome 11 position 62,883,597 bp and ending after 62,883,923 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 63155 | CAG GAC AGC ATT GTG GAT TG | Wild type Forward | A | |||
| 63156 | GGT GGG CAC TTG AGG GTA AG | Mutant Forward | A | |||
| 63157 | TGA TAT TTG TAG CTT GGC ACA G | Common | A | |||
| 63158 | Fluorophore-1 | TGT GTT GAA GTG CCA GGC AC | Quencher-1 | WT Probe | ||
| 63159 | Fluorophore-2 | TGC AGT GAA GTG CTC AGT TGT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 63155 | 0.40 uM |
| 63156 | 0.40 uM |
| 63157 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.