For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 112 bp
Wild Type = 97 bp
>chr10:82896279+82896375 97bp GCATGCGTCCATGAAGTCAC ACAATCTACAGGAAAAGGTTGAGC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 62933 | GCA TGC GTC CAT GAA GTC AC | Wild type Forward | A | |||
| 62934 | ACA ATC TAC AGG AAA AGG TTG AGC | Wild type Reverse | A | |||
| 62935 | Fluorophore-1 | CCT CAA GCC CAA GTG GTG | Quencher-1 | WT Probe | ||
| 62936 | CTG GGA TCT TGT GGG TAG GA | Mutant Forward | A | |||
| 62937 | CAG TAA AGA CTG TTG CAG ATG GA | Mutant Reverse | A | |||
| 62938 | Fluorophore-2 | AGC AAT CAG TTT TTG TCA TGG CTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 62933 | 0.40 uM |
| 62934 | 0.40 uM |
| 62936 | 0.40 uM |
| 62937 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.