For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:117809461+117809564 104bp GGACTCTTTGATCCTTTCTGGA AAACTTGGAGCTCGCAGGAG
Mutant= 98 bp
Wild Type = 104 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
ggactctttgatcctttctggatgaactcagtaGGaaggtattgctttgagacaaggcctcaaacttacagagccaaggatgacccaccctctgactt
This mutation is a a 4837 bp deletion beginning at Chromosome 11 position 117,809,495 bp and ending after 117,814,331 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 62806 | GGA CTC TTT GAT CCT TTC TGG A | Common | A | |||
| 62807 | AAA CTT GGA GCT CGC AGG AG | Wild type Reverse | A | |||
| 62808 | AAG TCA GAG GGT GGG TCA TC | Mutant Reverse | A | |||
| 62809 | Fluorophore-1 | TGA ACT CAG TAG GAC ATA TTT CCC A | Quencher-1 | WT Probe | ||
| 62810 | Fluorophore-2 | TGA ACT CAG TAG GAA GGT ATT GCT TTG | Quencher-2 | Mutant Reverse |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 62806 | 0.40 uM |
| 62807 | 0.40 uM |
| 62808 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.