Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr15:102147719+102147805 87bp GCCAGGAGAGACTGAATCCTT AGTCAGAGCAGAGACCAGCAG
Mutant= 97 bp
Wild Type = 87 bp
Wt Sequence (deletions in lower case)
GCCAGGAGAGACTGAATCCTTCAGTCCCTCTCACTTTACTGGTAGAAGTGGACctaggttccgaggctgctggtctctgctctgactgatctctgatttcccctcccactcttcctgtggccacagaggagactacaaaggagagcaaaccccaaggaggtgcctcccgctctcgtgacacaaaccacagagaccggcagaagaatccacggacctctgctgcccctatacggcccaatcctgttcaagatagtgagatggtgcgtgggggggtggtagggaaggcagagggctggagatttccactggactcaaggaagtctggaccaggcaggctcctagaatcctgagtaccgccctcacccacccctgtccttctctagggcccctgccgcagacacttggattcagtactgcagcagctccagactgaggtcttccgaggcggagcacgtgggctctatgtgccaaactgtgacctcagaggcttctaccgaaagcagcaggtgagaagaagctgcctgtcctctgtgcaagctctgtgcgcggcagtgaggaagggtacttgatgcaaagctgcaaaaaggatgctggttctgctggagcatgtctccaaaaacaacagccaggtggtggagagaggcaggtggatctctgtgagttcgaggccagcctggtctatgtagtgagttccaggacagccggagctacacagagaaaccctgtctggaaaaaccaaaaccagccaaacagcaaccaaaaaaaggatggatacacacacacacacacacacacacacaaaactatttcttccaattttaagacccacatagatatgaaaaacatcaggaagattgtaacttcaagacttgcctaggctacaagtgaagggctggtaggaagacagagggctggagatttccacaggagatctttccatggacttgaggaagcctggaccaggcaggctcctagaattctgagtgagttcaagtccagcctgggaaatttcacgagcctctgtctcaaaacaaaatgtaaaatgaaaagaagtttatagctcgttggcaaagctctgcttagcagtactgtgggctccatctctagcgtgatctgaaagaaaaacaaaggccaacaattgcaatgggagacttaaagtctcttctaggataaggccttgtggtggcctcaaatgggagccctggggaatcacctggaggcgtctgagctggtgctggtggagccccttctgcattttgtgactcagtaggtctgggctagcctgtgaacacaagtttctaacataagtgatgttgggctgttgacagaaactgcattttgaaagctattgctctggcctagcagagtgggccctattcagtaggtaaagcaactaagagctctcagatgctttcctgctcaaagcctggacctcaccctgacctgcacctctctccccagtgtcgttcctcgcaggggaatcgccgtggcccctgctggtgtgtggatccgatgggccagcctttgccagtgtctccagatggtcaaggaagcactcagtgctctgccaggagcagtgggtgaagccccgagggagcctccaggacgccagcaggaacagggggctgtcatttgagctgtatgtgaagcaatgaataactctgtgccccaagacccaccttcacgccccaccccattgtccctgtcacccttgggcctttacacagctagttagaaagattgctgttggcttgtgtactaataaaacagtattgggggggtgtctctggcttacgtctctgcgtctgtctcattcagatctggggcctcgtgctcactgtctcccattggtcatagtgtttctaccttccctgcagagcacagccagcctcttccattgcccttggaatacagtagacTGCCACTGCCACAGGCAGCAAGCCCTTTCTTTATCCTCACCCGG
This mutation is a 1866 bp deletion beginning at Chromosome 15 position 102,147,772 bp and ending after 102,149,637 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 62791 | GCC AGG AGA GAC TGA ATC CTT | Forward | A | |||
| 62792 | AGT CAG AGC AGA GAC CAG CAG | Wild type Reverse | A | |||
| 62793 | CCG GGT GAG GAT AAA GAA AG | Mutant Reverse | A | |||
| 62794 | Fluorophore-1 | TAG AAG TGG ACC TAG GTT CCG A | Quencher-1 | WT Probe | ||
| 62795 | Fluorophore-2 | AGA AGT GGA CTG CCA CTG CC | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 62791 | 0.40 uM |
| 62792 | 0.40 uM |
| 62793 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.