For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 118 bp
Wild Type = 119 bp
The WT Forward Primer (62352) anneals over the nucleotide sequence containing mouse genomic variations rs216960934
The WT Probe (62356) anneals over the nucleotide sequence containing mouse genomic variations rs219006159
>chr7:43677704+43677822 119bp GCGGGTATGTGAATTGAGGT TCACACCGACATACTTGACCA |
Sequence
Mutant Sequence, junction in uppercase:
ctccctgaaaccctgtcgtcgggtttttattttcttggtataggaagaagctgcccttcccgtgggctccccTGtgactgccttgcccagtcctggtatctgttgtgagtgaggaggg
Ctu1<em1(IMPC)J>:
This mutation is a 3606 bp deletion beginning at Chromosome 7 position 43,674,889 bp and ending after 43,678,494 bp (GRCm38/mm10)
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 62352 | GCG GGT ATG TGA ATT GAG GT | Wild type Forward | A | |||
| 62353 | TCA CAC CGA CAT ACT TGA CCA | Wild type Reverse | A | |||
| 62354 | CTC CCT GAA ACC CTG TCG T | Mutant Forward | A | |||
| 62355 | CCC TCC TCA CTC ACA ACA GAT | Mutant Reverse | A | |||
| 62356 | Fluorophore-1 | AGC AGT TAC ACA AAC GTT TAC AGC C | Quencher-1 | WT Probe | ||
| 62357 | Fluorophore-2 | CTG TGA CTG CCT TGC CCA GT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 62352 | 0.40 uM |
| 62353 | 0.40 uM |
| 62354 | 0.40 uM |
| 62355 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.