For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chrX:134604626+134604745 120bp CCTATAGTACTGTTACCCAG GCCATATGAGCAAAGACTGC
Mut= 100 bp
Wt= 120 bp
Fam=Mut
Hex=Wt
X-Linked
The WT Reverse primer (primer 62086) anneals over the nucleotide sequence containing mouse genomic variations rs259555446 and the Mut Reverse primer (primer 62087) anneals over the nucleotide sequence containing mouse genomic variation rs259168986.
Sequence
Wt Sequence:
TCGAAATTATCTAAAGGAAAAAAGTATCCATGGAAACAAAAAAAAATTCCTATAGTACTGTTACCCAGAAATAACCACTGTTAATTAGACCTGATACATAAGAGAAATGGTATAAGCACTCGCTAAGTGAATGGATTAAAAGTTTTATGCAGTCTTTGCTCATATGGCTCCTTTGAAAAACTTACTGATGTGAACTTGTAAAATAATAGTTTTCTTTGTTTCTCTTACTATATTATATACACTTTTTCATGACAATAGTTTTCTAATTTTTTTAAAGCCACATTGAATTTGCATTGAGCCA
Mutant Sequence:
AAAATTTAGAATATTCGAAATTATCTAAAGGAAAAAAGTATCCATGGAAACAAAAAAAAATTCCTATAGTACTGTTACCCAGAAATAACCACTGaactggcttttaaagttctctgctgttgaaattttaatttttttctcaaatattccaggctatgaatgactcaagttttgatcctcctgcctctacttcctaaggattagaattgcagtcatacgtcactgtccagttt
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 60947 | CCT ATA GTA CTG TTA CCC AG | Common | A | |||
| 62086 | GCC ATA TGA GCA AAG ACT GC | Wild type Reverse | A | |||
| 62087 | CAT TCA TAG CCT GGA ATA TTT G | Mutant Reverse | A | |||
| 62088 | Fluorophore-1 | AGC ACT CGC TAA GTG AAT GGA | Quencher-1 | WT Probe | ||
| 62089 | Fluorophore-2 | AAT AAC CAC TGA ACT GGC TTT TAA AG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 60947 | 0.40 uM |
| 62086 | 0.40 uM |
| 62087 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.