For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 135 bp
Wild Type = 130 bp
chr11:77476814-77476943 130bp GGTACTAGAGACAGCGTGAGCA GGCGGTACAGCTAGAAAAGAAC
The wt reverse primer (primer 59965) anneals over the nucleotide sequence containing mouse genomic variations rs214155141 and rs240652107.
Sequence
Wt Sequence (deletions in lower case): TCAGTAAATACCTGTTGAAAGCTTGGATGAGGTTGAATGGTGGCATGAACGCACCGTGGGTACTAGAGACAGCGTGAGCAAGCCATCCCCatgcccagcctcagattgtttaaatctccgttaggggtgggggtgaaggaagaacctctcccgagtgagctccctagttcttttctagctgtaccgccagctccaacgcctgtgccccgagctggcccaggaagctgagtcctttctgaacttcccttccacccagtgcctctggtatccaagatttgccctagtgacacatacaaagtgtggaagagtgggcagaacctgagggtagacaccacgcttttgggctttgaccatatgacctggcagagggggaatcgcagcttcgtcttcagaggtcaaggtcagtgaggcagtaagtctggcagggtgggagacagcggacagccccagactgccctgacccctgtgctgttccctggtggcagacacaagtgctgtggtcatggagattgaccatgaccgccgcgtggtgtacatggagaccctggcgctggccgggcaggatcgggagctactgctggctgccgcccagccctcggaggaacaggtgctgagcaggcttactgcgcccgttgtcaccacacagctcgacaccaagaacatctcctttgagaggtgagctggtgtagcctgggtggccaggagccagcccgatgggccattctttcacctggaccactctacctccccaggaacaagactggcattctgggctggcgcagtgagaagacagagatggtgaacgggtacgaggccaaggtgcgcacactcctgatccactttccccagcctgtgggtgcagaggcaacccagcatggaggaaaggcaggagaccaacaggttccccaggagaaggccgtttgcagaatccttagggtagtcacatccaaggctctgttcagacacgctgtatgggtgcagagaaacttgtaccaccctcatttcctccccacaacaggcagatgctcttatccccactctatagatgaggtactgagctttccccacagaccccacttaatcttaagcactccaccaagCTGGGGTTGCCGGTTGTTATCCTGGACTACAGATGAGGCCACGAGGATTGGAGTGGCTCACTGACCTAGTAGAGG
This is a 1010 bp deletion beginning at Chromosome 11 position 77,366,728 bp and ending after 77,367,737 bp (GRCm39/mm39). There is a 4 bp insertion AGGA at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 59964 | GGT ACT AGA GAC AGC GTG AGC A | Common | A | |||
| 59965 | GGC GGT ACA GCT AGA AAA GAA C | Wild type Reverse | A | |||
| 59966 | GTA CAC ATA GCC TGT AAG TGC TTC | Mutant Reverse | A | |||
| 59968 | Fluorophore-1 | TGA AGG AAG AAC CTC TCC CGA G | Quencher-1 | WT Probe | ||
| 61474 | Fluorophore-2 | CAT CCC CAG GAC TGG GGT T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 59964 | 0.40 uM |
| 59965 | 0.40 uM |
| 59966 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.