For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 142 bp
Wild Type = 144 bp
chr7:19082866+19083009 144bp GCTGTTTCCCCATCCCTA ATGCTTGGATAGTCCTGGTG
Sequence
Wt Sequence (deletions in lower case):
CTGTTGTTAGGGTCTAGGGGCGTTCCCAACAGTCACACCTCGTAGCCAACCAAAcgcgagggtctgtcgcgttgacc[...]tgactgttcactcctgggagagacttagcccacagtacccctgggtgagagggcagggcaggggccatccccactcctgcccaaactccaccccttgctatggtctgtgattttgaaagtgttaaattatggaagccctgagggccctccttgttcccctggacctcttatttatactaaagtccttgtttgcacagtgtttctgttccctggggcagggtagggtgggggttgcagtacttggcctccaagctgtgctctgaccaaaggaagcccaatcttagctgtttccccatccctagccccgagcagagagccctctgaaagatgagtctcgacccccaaagtcaagAGGCTGAGATGGCCTTCCTACTAGGTCCTTGGAGATGTTTGAAACTTGTTTTAAACACCAGGACTATCCAAGCATGCTCTCCTTGGGGAGAG
This is a 6894 bp deletion beginning at Chromosome 7 position 18,809,966 bp and ending after 18,816,859 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 60058 | GCT GTT TCC CCA TCC CTA | Wild type Forward | A | |||
| 60059 | ATG CTT GGA TAG TCC TGG TG | Common | A | |||
| 60060 | GTT AGG GTC TAG GGG CGT TC | Mutant Forward | A | |||
| 60062 | Fluorophore-1 | AGA TGA GTC TCG ACC CCC AAA G | Quencher-1 | WT Probe | ||
| 61123 | Fluorophore-2 | AGT CAC ACC TCG TAG CCA ACC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 60058 | 0.40 uM |
| 60059 | 0.40 uM |
| 60060 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.