Stock No: 036813
Protocol 42414: Probe Assay - Mafb<em#Lutzy>-P71R
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  70 bp

Wild Type = 70 bp

>chr2:160366224-160366293 70bp TAGTGCGCACCACCATCAC AGTCACACCTGCTCCTGGGTA

Sequence

Wt Sequence:

AGTGCCCCAGCCGCTGCAGAGCTTCGACGGCTTCCGTAGTGCGCACCACCATCACCACCACCACCACCCTCATCCGCACCACGGGTACCCAGGAGCAGGTGTGACTCACGATGACCTGGGCCAGCACGCTCACC

Mutant Sequence:

GCAGCCAGCCGGCTCGGTGTCCTCCACACCGCTCAGCACTCCGTGTAGCTCCGTGCCCTCGTCGCCCAGCTTCAGCCCGACCGAACAGAAGACACACCTCGAGGATCTGTACTGGATGGCGAGCA

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
60624 TAG TGC GCA CCA CCA TCA C Wild type Forward A
60625 AGT CAC ACC TGC TCC TGG GTA Wild type Reverse A
60629 Fluorophore-1 ACC ACC ACC CTC ATC CGC Quencher-1 WT Probe
60631 CTC AGC ACT CCG TGT AGC TC Mutant Forward A
60632 CGA GGT GTG TCT TCT GTT CG Mutant Reverse A
60633 Fluorophore-2 CCT CGT CGC GCA GCT TCA G Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
60624 0.40 uM
60625 0.40 uM
60631 0.40 uM
60632 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.