For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 107 bp
Wild Type = 107 bp
chr7:16368430-16368536 107bp CGAATCTTGGAGAGCATGAA GTCATTGAGACAGCTCATTTCC
Sequence
Wt Sequence (deletions in lower case):
TTGCTTGACTTTGTAGTTTAGATTACCTTGATAGCTCTGTCTTCATGAGAACTATGAGGTGTAGTTTATATGCTCATGGGTTAAGGAAACAGATTGTCTTGAGTGGTTTTACTGTCCAGCTAAATTCTTCTCTTAGGTGTCAGaagtggtcgtcatgtcgtgtatattttctacaccctgaaatctgcagcttttcttctgtcttttactcacagcacccaagaacctgttattcttgttgaaactggtcttaagcctgccagagagacagttaatttaagacttatgcagacagcagggcagtgattcacagtttgcagctcttagcagtcacttcctgtctcctctcaggtgtgcctgacttgctgctccagagatgtcatcattaaagtcgaccagatctgtcacagaaacagcattaagttcttcacaggagatgtctttgggtaccatgggtacacctttgcgaatcttggagagcatgaatttgtagagtaagtgctgggagagggccgaagggagcgttccacagttgAGTGGTATTTGTGGTAGGAAATGAGCTGTCTCAATGACATAGCATACTGTACTATAATACTTCAGAACATTCTCAGACAAGGGATTAACAAATTATGAAGC
This is a 392 bp deletion beginning at Chromosome 7 position 16,368,468 bp and ending after 16,368,859 bp (mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 60089 | CGA ATC TTG GAG AGC ATG AA | Wild type Forward | A | |||
| 60090 | GTC ATT GAG ACA GCT CAT TTC C | Common | A | |||
| 60091 | CAT GGG TTA AGG AAA CAG ATT G | Mutant Forward | A | |||
| 60092 | Fluorophore-1 | TAG GTG TCA GAG TGG TAT TTG TGG | Quencher-1 | MUT Probe | ||
| 60093 | Fluorophore-2 | TGT AGA GTA AGT GCT GGG AGA GG | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 60089 | 0.40 uM |
| 60090 | 0.40 uM |
| 60091 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.