For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 127 bp
Wild Type = 142 bp
chr2:174421508+174421649 142bp GACATCTCATGGACCCACACT TGGCCAGTCTACCAGTATCG
The wt reverse primer (primer 60085) anneals over the nucleotide sequence containing mouse genomic variations rs226470986.
Sequence
Wt Sequence (deletions in lower case):
TCTCTTGGCCATATAGAAAGGGCAGACATCTCATGGACCCACACTGTGTTTCTTTCTTTTGGGTGTTACCActgaatagacttagaggctaattctacagggtccagaatcttggctgctgttgctgtggtggtggtagagctctgcgatactggtagactggccatgctgttttgggggttcggaagggggtgctgcttcaggtaaagcttccatcttctcccaggcgttgagcctgtgcaggtgcaggagactgtggaaaaccacttgaagagtttgctgatcaagcacttcgaccctcggaaagcagattctattttcactgaagaaggagaggtgagggacgctgtccttgccccagcatgccacagccttggccagcatcctctCTGCACTCTGAGGAGTGAGGTGCTTGCATGGGAGGTTCCAGTGCTGAGGCCAGGAGCACCCAGTGTCTCCCCCGACTACTGCGTGCAGGTC
This is a 318 bp deletion beginning at Chromosome 2 position 174,421,555 bp and ending after 174,421,872 bp (mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 60084 | GAC ATC TCA TGG ACC CAC ACT | Common | A | |||
| 60085 | TGG CCA GTC TAC CAG TAT CG | Wild type Reverse | A | |||
| 60086 | AGT AGT CGG GGG AGA CAC TG | Mutant Reverse | A | |||
| 60087 | Fluorophore-1 | TGG GTG TTA CCA CTG CAC TCT G | Quencher-1 | MUT Probe | ||
| 60088 | Fluorophore-2 | AGG GTC CAG AAT CTT GGC TG | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 60084 | 0.40 uM |
| 60085 | 0.40 uM |
| 60086 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.