For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 148 bp
Wild Type =165 bp
Sequence
Wt Sequence (deletions in lower case) :
ATACACATACAGAGACAGACAGAAACACAGACATACAGAGATACAGTCACAGAGAGCTCAACAGAGACAGAGACAGACAGACAGACACACACACACACAGAGATAGACAAAGACAAATAGAGAGACAGAGATCAAGAGTGCACcagagcctatctggctactgaggagaaaggaatgggactggggaggcccctgtgtttgtgctctccaggcaaggaccacgtgtgcaggttcattggctgtggccgtaacgagaagtttaactatgtggtgatgcagctccaggtgtgtccttggggtccgctcacttgcctctttgcccaagagctggagcgtggtgtgggtggggcatgtggcaggaggcatccgttcttgatgggatgggtacacaggggggcaaggctgggtggtgaatgtggctgagatgggtcttccccctcccaccctgtcccaccctgtcctcccagggccggaacctggctgacctgcgccgcagccagccaaggggcactttcacgttgagtaccacactgcgcctgggcaagcagatcctggagtccattgaagccattcactccgtgggcttcctgcaccgtgacatcaagccggtaagcagtgcgctgagagctcctgtggtctgtgggtcctcgcttctcCACGACAGTGCTGGGCCCTCAGAGCCTCCTCTCTTTGAGCACTTCTTGATCTGTACCAAAGCCACAGCCCCTCTTTCTCGCCTCTTGGCCAAGCCAGGTTGAATGCCCGGCTCTCCATTTGCCTTCATCTCTCACCCATGACCCTGTGTCTTCAGTCTAGAGGTGGCACCTAACTTTCTGT
This is a 513 bp deletion beginning at Chromosome 17 position 46,789,743 bp and ending after 46,790,255 bp (GRCm39/mm39).
chr17:46478769-46478933 165bp GGCAAGCAGATCCTGGAGT CAAGAAGTGCTCAAAGAGAGGAG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 59172 | GGC AAG CAG ATC CTG GAG T | Wild type Forward | A | |||
| 59173 | Fluorophore-1 | ACT CCG TGG GCT TCC TGC AC | Quencher-1 | WT Probe | ||
| 59174 | CAA GAA GTG CTC AAA GAG AGG AG | Common | A | |||
| 59175 | Fluorophore-2 | AGT GCA CCA CGA CAG TGC TG | Quencher-2 | MUT Probe | ||
| 59176 | CAG TCA CAG AGA GCT CAA CAG AG | Mutant Forward | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 59172 | 0.40 uM |
| 59174 | 0.40 uM |
| 59176 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.