For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 83 bp
Wild Type = 110 bp
chr1:106000997+106001106 110bp CCTCCAGACGGACTCACTGT GCAGCAAGAGCAACAACTTC
Sequence
Wt Sequence (deletions in lower case):
AGTAGATAAACTTTATGTAATGATTAGCATACACAGTACCTCGGGAAATTAACATAAAGTATACTAGTTATTTTATATGTCCTTTTGATTCTGGTTCATGTGGTATAGAATGAATACCACTGGTAACTCTGattagcaacattggatttctgtgtgtaagatagctgggaaagaaaatatttgaaaagattattacttttaaataaaaatgagcattgatactgctacttgtgactctgacacatggtatctttttacccttaatgtttaatcacttgtaactagtataatcattattcagactgtatgacttgactctgtggaattttctcctctgatgtagattaacacattttctcttctagaacgactctgcctgtggtgactatatacagagtaatgagactggtttagtagagcaagcccagatacctccagacggactcactgtggcccctcatcgagctcagcgagaaggtgtgctgcatttgttgttttcacactgatcATCATAGGGTTTTGAAGTTGTTGCTCTTGCTGCTGGTGATGATGGTGGGTGGGTGGGTGGTTGGTTTGTTGGTTGAGAAAGGGTCTCACATAGCCCAAGTTAGCCCAGATTCACTATATATCTAAAGCTGAC
This is a 377 bp deletion beginning at Chromosome 1 position 105,928,427 bp and ending after 105,928,803 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 59125 | CCT CCA GAC GGA CTC ACT GT | Wild type Forward | A | |||
| 59126 | GCA GCA AGA GCA ACA ACT TC | Common | A | |||
| 59127 | CTT TTG ATT CTG GTT CAT GTG G | Mutant Forward | A | |||
| 59128 | Fluorophore-1 | ACC ACT GGT AAC TCT GAT CAT AGG G | Quencher-1 | MUT Probe | ||
| 59129 | Fluorophore-2 | AGC TCA GCG AGA AGG TGT GC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 59125 | 0.40 uM |
| 59126 | 0.40 uM |
| 59127 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.