Protocol 41598: Probe Assay - Pcdhga7<em1(IMPC)J> Alternate 1
Version 2.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mut = 82 bp

Wt = 95 bp

Fam = Mut

Hex = Wt

>chr18:37849443+37849537 95bp TGACAAGAATGCCCAAGTCA TACCCGTGTCAGAGTTGATG

 

Sequence

MUT Sequence (junction in uppercase):

tccaagacctctcagggtgtgagcgagatcctcaggGCaggtgagttaatctctttaccttttctgtgtgcctgtgtgtaaagtgctctcatgttgccaggtttcttcttctattgtcttggga

This mutation is a 2435 bp deletion beginning at Chromosome 18 position 37,847,990 bp and ending after 37,850,424 bp (GRCm39/mm39).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
57933 CCA AGA CCT CTC AGG GTG TG Mutant Forward A
57935 CTT TAC ACA CAG GCA CAC AGA Mutant Reverse A
57938 Fluorophore-1 CGA GAT CCT CAG GGC AGG T Quencher-1 MUT Probe
58732 TGA CAA GAA TGC CCA AGT CA Wild type Forward A
58733 TAC CCG TGT CAG AGT TGA TG Wild type Reverse A
58734 Fluorophore-2 ACC GGT GTC GTC CTA CGT CT Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
57933 0.40 uM
57935 0.40 uM
58732 0.40 uM
58733 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.