For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:8545451+8545551 101bp GCTGCAAATGACAATTTCCTA GTTAAGTCGGCAGCTGAATC
Mut= 135 bp
Wt= 101 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence:
tctgtctttctgtttctgactttctctcactacaatgcactccaggtttatctacatagctgcaaatgacaatttcctaaatttatgatcaaaagcatttatgcagatgctgcactccatgacattaaagcagttgcatgattcagctgccgacttaacactctgctgttccttccacagACATGGAGGTGAAGCAGATCAACAAGCGGGCCTCTGGCCAGGCTTTTGAGCTGATCTTGAAGCCACCATCTCCCATCTCAGAAGCTCCACG
Mutant Sequence:
gtttctgactttctctcactacaatgcactccaggtttatctacatagctgcaaatgacaatttcctaaatttatgatcaaaagcatttatgcagatgctgcactcgaATAACTTCGTATAGCATACATTATACGAAGTTATtgacattaaagcagttgcatgattcagctgccgacttaacactctgctgttccttccacagACATGGAGGTGAAGCAGATCAACAAGCGGGCCTCTGGCCAGGCTTTTGAGCTGATCTTGA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 58405 | GCT GCA AAT GAC AAT TTC CTA | Forward | A | |||
| 58406 | GTT AAG TCG GCA GCT GAA TC | Reverse | A | |||
| 58407 | Fluorophore-1 | CTG CAC TCC ATG ACA TTA AAG C | Quencher-1 | WT Probe | ||
| 58408 | Fluorophore-2 | AGA TGC TGC ACT CGA ATA ACT TCG T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 58405 | 0.40 uM |
| 58406 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.