For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mut = 117 bp
Wt = 108 bp
Fam = Mut
Hex = Wt
>chr3:27938649-27938756 108bp GTAACCAGTGTCAAGAATGTTCCA AACTGGCAAGTGGTGCCTAC
Sequence
MUT Sequence (junction, and insertion, are in uppercase):
ctacacggccatttctcattcaaaccagcacgcaaagcctagggcgagatctatgaagccaagatttaactgtcgtgacctaacagGTCaactggttttgctgtaggcaccacttgccagtttttctctcagcctagaatcttaaaactgtgtgtgggaatatagcaatggtacctattcccacctctttggtatttttctctctttttataatttttttaaattaactgacaatttcacacatatt
This mutation is a 2249 bp deletion plus a 1 base pair insertion (T) beginning at Chromosome 3 position 27,938,683 bp and ending after 27,940,931 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 58142 | AAC TGG CAA GTG GTG CCT AC | Common | A | |||
| 58143 | GTA ACC AGT GTC AAG AAT GTT CCA | Wild type Forward | A | |||
| 58144 | CGG CCA TTT CTC ATT CAA AC | Mutant Forward | A | |||
| 58145 | Fluorophore-1 | TGG ATG CAT GTG TGG ACG TAT | Quencher-1 | WT Probe | ||
| 58146 | Fluorophore-2 | AAC TGT CGT GAC CTA ACA GGT CAA C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 58142 | 0.40 uM |
| 58143 | 0.40 uM |
| 58144 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.