For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mut = 89 bp
Wt = 98 bp
Fam = Mut
Hex = Wt
>chr7:112554848+112554945 98bp AGGACTCAGATACTGGGCTGAG GCTTGCTCCCTACTACTTCTACA
Sequence
WT Sequence (deletions in lower case):
TCGGGAGCTGCCAGGTTGCCCGCGCTGGCCCTGCTGCCCTAATTGCACCTAGCCGGACTTGCTCCTCACGTCCCGGTTGCGCCATGgatccttcggagaagaagatatcggtgtggatctgccaggaggagaagctggtgtccggcctctcccgccgcaccacctgctcggacgtggtgcgggtgcttttggaggacggctgccggcggcgctgcaggcagcggcggggccagcgacggggcttgacggaagacccttcgggccagttggagctgcccgagcccccggacgaaaacgacgaggatgacgacgacgcgatgcccccgggcatgctatgtgggcccccgcagtgctattgcattgtggagaagtggcgcggctttgagcgcatcctgcccaacaagacgcggatcttgcgcctctggactgcttggggcgacgagcaggagaatgtacgcttcgtgctggtgcgcagcgaagcgtcgctgcccaacgccggaccgcgcagcgccgaggcgcgggtagtgctcagccgcgagcgcccctgcttggcccggggcgccccagcacggcccagcctggccttgacccaggagaagcagcggcgggtggtacgcaaggccttccgcaaactggccaagctcaaccggaggcgccagcagcagccgtcgtcaccttgttcgtccacgtcgtcgtccaccgcctcgtcctgctcgtcgtctgctcggacccacgagagcgcgtcggtagaacgtatggagacgctggtgcatctggtgctgtcgcaggaccacacgattcgccagcaggtgcagcggctccgggagctggaccgcgagatagaccgctacgaagccaaggtgcacctagaccgcatgcggaggcacggagtcaactacgtgcaggatacctatctagtgggggccggcatcgacctggacggacaaactcctgaaggggagccggaagatgcgacactggaggagaaggggacagaaccggcggcacccctggacagcgaggcgcaggcggcagcgttggaggagctggccaggcgctgtgacgacctggtgcggctgcaggaggagcgcgcccagcaggaggagttgctagagcgcctgtccgccgagatccaggaggaactgaaccagcgctggatgcagcggcgcaatgaggagctggcggctcgagaggagtccctagagcccgatggtggtccggatggcgagctgctgctggagcaggagcgggtcaggacgcagctcagcaccagcctttacatcgggctgaggctcagcacggacctggaggccgtcaaggcggacttggattacagccagcagcagagggacattaaggagcgcgagcttcagggccttctccagagtttgcacacttttgagcagacggtggtgcatgatggggctctgggttccagcggaccctctcgcgaacctcagcctcagacctgtgcagaaatgtgggtagaccaggcccggggactggctaagagttgcccgggcaacgatgaggactcagatactgggctgagctccatgcatagccaagactcagactcggtaccccctgtgtgtgAATCCCTTGTGTAGAAGTAGTAGGGAGCAAGCTTAGACGCTTGCAGAATGCACTGGTTTGGCCTGCTCAGG
This mutation is a 1510 bp deletion beginning at Chromosome 7 position 112,553,404 bp and ending after 112,554,913 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 58137 | GCT TGC TCC CTA CTA CTT CTA CA | Common | A | |||
| 58138 | AGG ACT CAG ATA CTG GGC TGA G | Wild type Forward | A | |||
| 58139 | CCT GCT GCC CTA ATT GCA C | Mutant Forward | A | |||
| 58140 | Fluorophore-1 | AAG ACT CAG ACT CGG TAC CCC CT | Quencher-1 | WT Probe | ||
| 58141 | Fluorophore-2 | CCG GTT GCG CCA TGA A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 58137 | 0.40 uM |
| 58138 | 0.40 uM |
| 58139 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.