For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mut = 117 bp
Wt = 122 bp
Fam = Mut
Hex = Wt
>chr3:69223001+69223122 122bp CACTGGAGAAGGGCTGGAT CCATTTCCACTTCATCATTGTC
Sequence
WT Sequence (deletions in lower case):
GAAACGATCTTTAAGGAAGAAAAAGCCTAAAATGGGTCTGCTGAATTCTAAAAACCCCCAAAGCAAGCAAGCCcacattcttctcctcggacttgactcagctgggaaatctactctgctttaccggttaaagtttgctgagactctctcaaccatcccaaccatcggcttcaacgtggaaatggtccagctgcagagcagtctcacactcaccgtgtgggatgttggaggacaggagaagatgcgaacagtctgggactgctactgtgagaacgctcaagggctgatgtacgtggtggactgttccgaaggcaaaaagcgactggaagactctcgcaaagagttcaaacacattttgaagaacgagcacatcaaaaacacaccggtcgtcatactggccaacaaacaggacttgccgggagctctgagcgccgaagacatcaccaggatgttcaaggtgaagaagctgtgcagcaaccggaactggtatgtgcaaccctgctgtgcggtcactggagaagggctggatgacgggttcaggaaattaaccgagtttctgaaaagctaccgaaggacaagagagaccttagcaatcttCAAGCAGAAATGAGACAATGATGAAGTGGAAATGGGAAA
This mutation is a 524 bp deletion beginning at Chromosome 3 position 69,129,897 bp and ending after 69,130,420 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 58118 | CCA TTT CCA CTT CAT CAT TGT C | Common | A | |||
| 58119 | CAC TGG AGA AGG GCT GGA T | Wild type Forward | A | |||
| 58120 | GGG CCA AAA GAA ACG ATC T | Mutant Forward | A | |||
| 58121 | Fluorophore-1 | ACG GGT TCA GGA AAT TAA CCG | Quencher-1 | WT Probe | ||
| 58122 | Fluorophore-2 | CCA AAG CAA GCA AGC CCA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 58118 | 0.40 uM |
| 58119 | 0.40 uM |
| 58120 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.