Protocol 41322: Probe Assay - Zcchc3<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mut = 135 bp

Wt = 151 bp

Fam = Mut

Hex = Wt

>chr2:152256184-152256334 151bp AGGAAGAAGGCCGAGGTGA CGTCTCCCTGGAAACAGATG

Sequence

MUT Sequence (junction in uppercase):

gccatgggcacctcggaccgcgggaacgagtggaggatgctgggaaagaggTAcactgccagcttacccctcccttaagtgccaaaactttttttttaacctttttttttttaatcgttttgaatggagatatttctaaaacctaccagagacgttctctct

This mutation is a 1232 bp deletion beginning at Chromosome 2 position 152,255,469 bp and ending after 152,256,700 bp (GRCm39/mm39).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
58057 AGG AAG AAG GCC GAG GTG A Wild type Forward A
58058 CGT CTC CCT GGA AAC AGA TG Wild type Reverse A
58059 AAC GAG TGG AGG ATG CTG Mutant Forward A
58060 GAG AAC GTC TCT GGT AGG TTT TAG Mutant Reverse A
58061 Fluorophore-1 CCG GCA CGA CCG AAG AT Quencher-1 WT Probe
58062 Fluorophore-2 AGG TAC ACT GCC AGC TTA CCC C Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
58057 0.40 uM
58058 0.40 uM
58059 0.40 uM
58060 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.