Protocol 41298: Probe Assay - Magi3<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mut = 100 bp

Wt = 90 bp

Fam = Mut

Hex = Wt

>chr3:104055178-104055267 90bp AGTAAACCCCGCTCCTCTTG CTTTCCATTAGGTCAAAAGGTTAGG

Sequence

MUT Sequence (junction in uppercase):

gcttcagcacctttgacctctggtcctcctctggttttcctgtgctctctctcagccctttTTtttctcacaccctgaaagagctgcctcctttcttctggagagcagctccttgctatgaaaatg

This mutation is a 7616 bp deletion beginning at Chromosome 3 position 103,956,433 bp and ending after 103,964,048 bp (GRCm39/mm39).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
57961 AGT AAA CCC CGC TCC TCT TG Wild type Forward A
57962 CTT TCC ATT AGG TCA AAA GGT TAG G Wild type Reverse A
57963 GCT TCA GCA CCT TTG ACC TC Mutant Forward A
57964 CAG AAG AAA GGA GGC AGC TC Mutant Reverse A
57965 Fluorophore-1 CTC GTA ACC ACC GAG CCA TCT Quencher-1 WT Probe
57966 Fluorophore-2 CTG TGC TCT CTC TCA GCC CTT TTT Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
57961 0.40 uM
57962 0.40 uM
57963 0.40 uM
57964 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.