For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mut = 111 bp
Wt = 106 bp
Fam = Mut
Hex = Wt
>chr12:78961590+78961695 106bp ACTGCAGGAGTTAGGGAGCA AACCAGGATGGCTGGTGGT
Sequence
MUT Sequence (junction in uppercase):
acctccagcctgggactgcaggagttagggagcattggagtggacacaggtgACtaccttctgtatcacctcaactccctgttagcactggctttcttctgagaaactctacgcaaatactatgtgaaaatgtctactgaa
This mutation is a 3696 bp deletion beginning at Chromosome 12 position 79,008,403 bp and ending after 79,012,098 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 57776 | ACT GCA GGA GTT AGG GAG CA | Common | A | |||
| 57777 | AAC CAG GAT GGC TGG TGG T | Wild type Reverse | A | |||
| 57779 | Fluorophore-1 | TGG CAG CGC CAC ACC | Quencher-1 | WT Probe | ||
| 58735 | ACA TAG TAT TTG CGT AGA GTT TCT CAG | Mutant Reverse | A | |||
| 58736 | Fluorophore-2 | CTC AAC TCC CTG TTA GCA CTG GC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 57776 | 0.40 uM |
| 57777 | 0.40 uM |
| 58735 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.