For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chrX:73919816-73919905 90bp CAGTGGTCGGACTTGTACCC CTGGTCCATCAGCTTCTGAG
Mutant = A, A, T
Wild type = C, G, C
X-Linked
Sequence
agactggagataattgaaggagccacagtggtcggacttgtacccaatcttcttctctcagGCTGTGAAGCGTTCCCAC(c/a)G(g/a)(c/t)GCCTTGGCCTGGCTCAGAAGCTGATGGACCAGGCCTCTCGAGCCATGATAGAGAACTTCAATGCCAAATACGT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 57102 | CAG TGG TCG GAC TTG TAC CC | Forward | A | |||
| 57103 | CTG GTC CAT CAG CTT CTG AG | Reverse | A | |||
| 57104 | Fluorophore-1 | CCC ACC GGC GCC TTG | Quencher-1 | WT Probe | ||
| 57105 | Fluorophore-2 | TTC CCA CAG ATG CCT TGG C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 57102 | 0.40 uM |
| 57103 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.