For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:30134148-30134260 113bp GAGCGGAGAGGTCTTCTAGG CACCAGAACACAAAATGCAG
Mutant = C, T
Wild type = A, C
Sequence
AGGAGCGGAGAGGTCTTCTAGGGTCTTCATTCAAGAG(A/C)ACCAG(C/G)CCGTTCCTCACTCATCAGGTGTTCAACAGgtttgtgtggcttcagcaaatcctgcattttgtgttctggtg
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 55126 | GAG CGG AGA GGT CTT CTA GG | Forward | A | |||
| 55127 | CAC CAG AAC ACA AAA TGC AG | Reverse | A | |||
| 55128 | Fluorophore-1 | AGA ACC AGC CCG TTC CTC AC | Quencher-1 | WT Probe | ||
| 55129 | Fluorophore-2 | AGC ACC AGT CCG TTC CTC AC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 55126 | 0.40 uM |
| 55127 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.