For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:8513641+8513731 91bp GTCAGCCCCACAGGGATAGT ACAACAGTGCGTGTTTTTCC
Mut= 107 bp
Wt= 91 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence:
tatgttcgtgtcactccagtagctagttgtttgtgaaaggctaaataaaattggtctcaaagcatgtggcagctagctgcacaaacccagacctgggtgtggtcagccccacagggatagttaatccgaagcagcttcccaccaggttttttgtttgtttgcttgtgtttgtggaaaaacacgcactgttgttacgatgtaatctgtaacattgtatgaatgtctgatccacagaaaacactcaaacccaaatgcttccagaaccgaagctatttgcctcctagttcttgcaattgggagaccat
Mutant Sequence:
GAATTATGTGTTCTGCCCCATCACTCTCTCTTAATTGGATTTTTAAAATTATATTCATATTGCAGGACTCGGCAGAAGACCTTCGAGAGAAAGGTAGAAAATAAGAATTTGGCTCTCACATGAGGATCACCCATGTCGAGAGAGAGAGACAGACAGCCTGCCTAAGAAGAAATGAATGTGAATGCGGCTTGTGGCACAGTTGACAAGGATGATAAATCAATAATGCAAGCTTACTATCATTTATGAATAGCAATACTGAAGAAATTAAAACAAAAGAT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 54891 | GTC AGC CCC ACA GGG ATA GT | Wild type Forward | A | |||
| 55611 | ACA ACA GTG CGT GTT TTT CC | Wild type Reverse | A | |||
| 55612 | CTC GGC AGA AGA CCT TCG AG | Mutant Forward | A | |||
| 55613 | CAT TTC TTC TTA GGC AGG CTG T | Mutant Reverse | A | |||
| 55614 | Fluorophore-1 | AGC AGC TTC CCA CCA GGT T | Quencher-1 | WT Probe | ||
| 55615 | Fluorophore-2 | CTC TCA CAT GAG GAT CAC CCA TG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 54891 | 0.40 uM |
| 55611 | 0.40 uM |
| 55612 | 0.40 uM |
| 55613 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.