For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:115575875+115575964 90bp GTGTTCTTAACCCCTCTTAGCC AGGCCTCACTGGCTAAATCC
Mut= 90 bp
Wt= 90 bp
Fam=Mut
Hex=Wt
The mutant probe (primer 55233) anneals over the nucleotide sequence containing mouse genomic variations rs49091205.
Sequence
Wt Sequence (deletion in lower case):
GTAGATCTGCCGGCCACTGCTGCGATTAAAGGTGTGCCTCACTACATGTGGCCTTCCTGCTGACTTGTAGACCACTTATTAGACTGTATGTGAGCAAGTACCTTCCGAGCATCACCAACAGCACAGTTTAAAGCCAGCGCCCAGGCCGGAGAGCAGAGCAGGCAGTCGTAGCCCTgctgagccctgctctgtagggagagggagatgctggggtcttgggcttcttctatccatcgttggtttagcaagtgtctcctgcactcggggcgtttctgttccatgtgcctgttttctccttgagattttacaaggtgcggggcttactagggcgtctggtaccaggatcccagctgacaggactgatgtaagcggacactcaccgctgtgcttgttgttgagactctgtgaactctgctttcagatctgccagagggagccgtgaaagggctctgcaagttgttctgcttgacactgcatcgatataggtgagcccccagagaccagggcttagaccgtgccatacagcgacactgtgtcagagagacagcatggggcagtggggagagcccctagttgttagagccagactcttaggttcatgctcttaactactggatcctgggcaagttacttagcctccctatgcctcagttttctcatctgcaaaatggggatgatagcattttgtacctcatgggaagttgttagtgtgaaggcctgggacactgcctgccttattataatatctcagcgcatgtatgcaatcattagctgcacttataaagctataaaggagtcatggggcatatacaccatgagcatagattctgcccttcttgtcatcctgtgctctttctggggtgaggtgggtttatcaggttcatctctgtcccctaggggcccctgaaatgtaggaccatgagtgtccccccgaagagcagtgcttgacttcagcagccctgtctctgctgaggtcacatgtcactaccccttccttccctctttagagacgcagcctctcgcagagccctgcaggcagccatccagcagctggccgaggcccagccagaggccaccgccaagaacctcctgcactctctccagtcttcaggggttggctccaaagcatgtgttcccaggtacgggcctggggctgcgggcctccggggggtggtgccaacttctcaggtaggctggtgtagagccactggtgggagcacatctggccctcttacctttgtactctgaatggcactagagagcgcctctgagtggggagaggaaccaagttagtagagaaaagatccagtgggcccgaggcactggatgggcaaagctttatatacttgttcatgtacattttatgtgaatgagtctcttactgcacgtatgtctgtatactatgtgcatgcctagaacctgaggataccaggggagggggtcaggtccccgggacagtgggagctgccatgtggttgctgtgagaatcgaacccaggtcctttggaagagcaacctgtgttcttgttttttggttttttgtttgtttgttttgttttttgtttttgtttttttcgagacagggtttctctgtatagccctggctgtcctggagctcactttgtagaccaggctggcctcgaactcagaaatccgcctgcctctgcctcccaagtgctgggattaaaggcgtgcaccaccatgcccggctgcaacctgtgttcttaacccctcttagccgtctctccaacctcatcttgtttttactgtcccaaacatcaagggatGGGATTTAGCCAGTGAGGCCTGGACGCTTGTCCTGTTTATCACTGATGGTGTTGGGGGAGGGTTCATACACACACACCATGCTGTGCCACAGGGTGAACATTGTTGTCCCCCCCCAATCCCCCGTGGAGGCTGGAACCCCGCACTAAGCTCTTCTCCTCCCGCTTCTCCTTTGTAGCAAGA
This mutation is a 1611 bp deletion beginning at Chromosome 5 position 115574333 bp and ending after 115575943 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 55229 | GTG TTC TTA ACC CCT CTT AGC C | Wild type Forward | A | |||
| 55230 | AGG CCT CAC TGG CTA AAT CC | Common | A | |||
| 55231 | GAG CAT CAC CAA CAG CAC AG | Mutant Forward | A | |||
| 55232 | Fluorophore-1 | TGT CCC AAA CAT CAA GGG AT | Quencher-1 | WT Probe | ||
| 55233 | Fluorophore-2 | CCG GAG AGC AGA GCA GG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 55229 | 0.40 uM |
| 55230 | 0.40 uM |
| 55231 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.