For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:51491479+51491581 103bp TCGCTGCGTATACATCTGTG ACTTCAGTGTCCCAAGGATTTAC
Mut = 122 bp
Wt = 103 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence:
Mutant Sequence:
This mutation is a 137 bp deletion beginning at Chromosome 10 position 51,481,213 bp and ending after 51,481,349 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52948 | TCG CTG CGT ATA CAT CTG TG | Common | A | |||
| 52949 | ACT TCA GTG TCC CAA GGA TTT AC | Wild type Reverse | A | |||
| 52952 | Fluorophore-1 | AGA GTG CTG CTG GCT TCT CA | Quencher-1 | MUT Probe | ||
| 54744 | TTC CCT GAT GTC CTC TCA CC | Mutant Reverse | A | |||
| 55122 | Fluorophore-2 | ATC TGG TGT TGG GGT TCC TG | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52948 | 0.40 uM |
| 52949 | 0.40 uM |
| 54744 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.