Protocol 39822 - Dlx4<em1(IMPC)>

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr11:95140773-95140865 93bp TTGGCCACCATAGAGTCTCC GAGCTGGGGCCTTTTACA

Mut = 98 bp

Wt = 93 bp

Fam = Mut

Hex = Wt

Sequence

MUT Sequence (junction in uppercase):

tggcggaacattaagctttccggacctgaatcactttccttctgaagcaaccgcgctggggcccgcaggaaataCCactgagccatctctccagcccaacattagattctcggtatgcctctgctgccagctagctctggggttctggctcaggaacattgtaacagcctgt

This mutation is a 2312 bp deletion beginning at Chromosome 11 position 95140139 bp and ending after 95142450 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer	5' Label	Sequence 5' → 3'	3' Label	Primer Type	Reaction
54698		TTG GCC ACC ATA GAG TCT CC		Wild type Forward	A
54699		GAG CTG GGG CCT TTT ACA		Wild type Reverse	A
54700		CAT TAA GCT TTC CGG ACC TG		Mutant Forward	A
54701		TCT AAT GTT GGG CTG GAG AGA		Mutant Reverse	A
54702	Fluorophore-1	ATT ACT GGT GGT GGC CCA G	Quencher-1	WT Probe
54703	Fluorophore-2	CCC GCA GGA AAT ACC ACT G	Quencher-2	MUT Probe

Reaction A

Component	Final Concentration
Kapa Probe Fast QPCR	1.00 X
ddH2O
54698	0.40 uM
54699	0.40 uM
54700	0.40 uM
54701	0.40 uM
Wt Probe	0.15 uM
Mutant Probe	0.15 uM
DNA

Cycling

Step	Temp °C	Time	Note
1	95.0	--
2	95.0	--
3	60.0	--
4		--	repeat steps 2-3 for 40 cycles
5	40.0	--	Forever

JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.