For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:15976839-15976948 110bp ACAGTTTCCCTTCTGCCAAG GTGACCCTGACATCAAACTGG
Mut = 100 bp
Wt = 110 bp
Fam = Mut
Hex = Wt
Sequence
MUT Sequence (junction in uppercase):
aaaagagcccagttcccaagtgcagtgcccagaacatccacccacacacacccatttcccatggctggccattCCatctccagtttgatgtcagggtcactgtttcttcagcttgtcaggtgtggtgggga
This mutation is a 3648 bp deletion beginning at Chromosome 7 position 15,976,865 bp and ending after 15,980,512 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 54693 | GTG ACC CTG ACA TCA AAC TGG | Common | A | |||
| 54694 | ACA GTT TCC CTT CTG CCA AG | Wild type Forward | A | |||
| 54695 | AAA AGA GCC CAG TTC CCA AG | Mutant Forward | A | |||
| 54696 | Fluorophore-1 | ATT GGC AGG CTG CCG AC | Quencher-1 | WT Probe | ||
| 54697 | Fluorophore-2 | CCA TGG CTG GCC ATT CC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 54693 | 0.40 uM |
| 54694 | 0.40 uM |
| 54695 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.