Protocol 39639: Probe Assay - Ms4a4d<em1(IMPC)J> Alternate3
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  71 bp

Wild Type = 159 bp

>chr19:11554446+11554604 159bp GAAATATGCAGGAGGGACCTG CAGGTGATTCTCAAGGACACAA

Sequence

MUT Sequence (junction in uppercase):
 

tatcttatctaagctattggtttattattattattattattattattattattatttatcacatgggaagatttcatttGGaggcaagggctcactgactcttgcaaaagcaacagtcaacattctgatcacaaaatcaatgttggggtgatacccaaggaggggct

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
53411 CAG GTG ATT CTC AAG GAC ACA A Wild type Reverse A
53414 Fluorophore-1 AGG CTC TCC AGT TAA TGT GTC AAA Quencher-1 WT Probe
54093 GAA ATA TGC AGG AGG GAC CTG Wild type Forward A
54283 CAT GGG AAG ATT TCA TTT GG Mutant Forward A
54284 GTG ATC AGA ATG TTG ACT GTT GC Mutant Reverse A
54285 Fluorophore-2 CAA GGG CTC ACT GAC TCT TGC A Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
53411 0.40 uM
54093 0.40 uM
54283 0.40 uM
54284 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.