For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:138989025+138989118 94bp AGCAAAGGATTAGCATGTCCA TTTGCTGAGAACCAAGTCTGA
Mut = 98 bp
Wt = 94 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AAGGAGCAAAGGATTAGCATGTCCAATGCACGGAGTCCCTGTCCGAGGATACTGCAcagcggtagatgcctctgggatcagacttggttctcagcaaatacagtcaggacagcatcttggatgagagtagacgaggagtcagctatgcccctgccccaacaccaagaccctgagctctaggctgaagtctcatggctgaggggccactgtggcatctggccaggtacaatctgctcaccgtggctgtgtttttccttcaggtgactgagaaaatgtaacggaggacacctgccaagagtttggcgtggataccctggcccagacggagcagctgcccctgggtgtctttctggccatccagcctcaccatgtcaaagaagggtgcaggcagccgggccaagggggacaaagcagagacactcgctgcattgcaggctgccaacgaggagctgcgagccaagctcacagacatccagatcgagctgcagcaggagaagagcaaggtgggcactgaagcctctacccctggtccccagcttctgccccagccctggtcccctgccctgagctcctgatgcaggacccctgccccaggttccctgccccagtcccctcccacccccgtcatagactcccatcccaggtttcttgccctaagctccttctccaagtctcttgctcaaagctcctgcccctggagccaaatgattctatataaaggaggatgtgaccaagtctctgcagaggttcctgcttctttaccctggTGGGTATCTCTGGGGAAGAGAATGGCAGGTGGAGAGACTTGGGAGTTCAAAATCCATTGGGAGT
This mutation is a 711 bp deletion beginning at Chromosome 7 position 138,989,077 bp and ending after 138,989,787 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53068 | AGC AAA GGA TTA GCA TGT CCA | Common | A | |||
| 53960 | TTT GCT GAG AAC CAA GTC TGA | Wild type Reverse | A | |||
| 53961 | ACT CCC AAG TCT CTC CAC CTG | Mutant Reverse | A | |||
| 53962 | Fluorophore-1 | AGC GGT AGA TGC CTC TGG GA | Quencher-1 | WT Probe | ||
| 53963 | Fluorophore-2 | CTG CAT GGG TAT CTC TGG GGA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 53068 | 0.40 uM |
| 53960 | 0.40 uM |
| 53961 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.