For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:31201564-31201674 111bp AGGCCAAGATCTGGAGTTTGA CCACGACCCTTAAACACACC
Mut = 110 bp
Wt = 111 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GAGATTCCACAAGCACCCTCCCCTCTTTAGTGGATACTGAAGATTCCTTCGACgaaggtcctggggccctggtgttggagagcgatttgctactaggccaagatctggagtttgaagaggaagaggaagaggatgaaggtgacggccacaacgaccagctcATGGGCTTTGAGAGAGACTCTGAAGGTGTGTTTAAGGGTCGTGGTTTAGGATTAGTGGCAATTGGT
This mutation is a 108 bp deletion beginning at Chromosome 5 position 31,201,608 bp and ending after 31,201,715 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53570 | CCA CGA CCC TTA AAC ACA CC | Common | A | |||
| 53571 | AGG CCA AGA TCT GGA GTT TGA | Wild type Forward | A | |||
| 53572 | ACT GCT TGG GAG GGA GAT TC | Mutant Forward | A | |||
| 53573 | Fluorophore-1 | AGG AAG AGG ATG AAG GTG ACG | Quencher-1 | WT Probe | ||
| 53574 | Fluorophore-2 | CAC CCT CCC CTC TTT AGT GG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 53570 | 0.40 uM |
| 53571 | 0.40 uM |
| 53572 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.