For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr16:32256464+32256577 114bp GCTGTGGAGTCTTCAAAAAGC GCTAGCGCAGGGTTTAGGA
Mut = 109 bp
Wt = 114 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GACTGTAATTTCACCTTGTTTAAAGGTAATGCTGTGGAGTCTTCAAAAAGCCCGTCCTgtttggattacaaatttacaggaggatgaaacagaggaaacggaaggcccccagacccctggtcggctcctaaaccctgcgctagcccactctgtctctgtagcgtcgtgcggcaatatttttagctgtggtgcagaggatggtaaggtgcgcatcttcagggtgatgggagtcaaatgtgagcgagaactgggatttaagggtcacactttgggggtatcccaggtctgctttctgcccgagtccagtctgttgcttactggagggaatgatgggaggatcaggttgtgggatgtgagcggtaagatggagaagctgcagaagagccctgcgaggcacatccacaggaagaaagcaaagagggcagcgtgccccacgcagggtggaaactccagagccccaggagccgaggatgaggggcatgcaaagattctgccaaagctcgatattgaacacggagaaaaagtgaactggcttttaagtacaaaaattaaagggaacaaaagcatattagtggctgatcaaacgagttgtgtgtctgtgtatcccctaaatgagcTTTAGGTCCAATAAAATGCATTGCAAAAACCAACAGTAATTTTGGTTTTTTTTGTTTTTTGTTTTGTTTCCTTGCTGACTTATTAAGACACTT
This mutation is a 559 bp deletion beginning at Chromosome 16 position 32,256,492 bp and ending after 32,257,050 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52407 | GCT GTG GAG TCT TCA AAA AGC | Common | A | |||
| 52408 | GCT AGC GCA GGG TTT AGG A | Wild type Reverse | A | |||
| 52409 | AAG TCA GCA AGG AAA CAA AAC A | Mutant Reverse | A | |||
| 52410 | Fluorophore-1 | ATG AAA CAG AGG AAA CGG AAG G | Quencher-1 | WT Probe | ||
| 53390 | Fluorophore-2 | AGG TCC AAT AAA ATG CAT TGC AA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52407 | 0.40 uM |
| 52408 | 0.40 uM |
| 52409 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.