For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:122432484+122432599 116bp GAACATTTCTCAATGTCCCAGA CCGGCTCCTTAAAACAAAGT
Mut = 110 bp
Wt = 116 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GGAACATTTCTCAATGTCCCAGAGGCAGCATCTTTGGGTCAGATAttaggaggtgttttgcgaggatcacatggctaagaaaaacaaggataatagtactttgttttaaggagccggtctttatttgcacagggctgtgggttggtttttctgctagaaagtagaatagtagtcgggcatcaaatgagcgcgcgctcacggcgcagtgtttgctgtgcggatactcttgctttaccgttctctgtttcgtgtgtgtagataaacatgatgctggcaaacctgtacaagaaggctggtcaggagcgcccatcagtcacaagctataaggaggtcctgcggcagtgccctttggcccttgacgccattctaggtacagaaagttttctccctggtgcctggggtgtttgcagtcttagatgatggttctcagtcacaactatggttagatagagcagggtttttttttcagattTTAATTTTATGTTAATGTGAATGAGGGTTTTGTCTGTATGTCTGTATGTATGTAGTGTCTAATGCCATAATGGTTGGAGGGGGGCATTGGAGCCCCAAGAG
This mutation is a 427 bp deletion beginning at Chromosome 5 position 122,432,528 bp and ending after 122,432,954 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51530 | GAA CAT TTC TCA ATG TCC CAG A | Common | A | |||
| 51531 | CCG GCT CCT TAA AAC AAA GT | Wild type Reverse | A | |||
| 51532 | GGC ATT AGA CAC TAC ATA CAT ACA GAC | Mutant Reverse | A | |||
| 51533 | Fluorophore-1 | CGA GGA TCA CAT GGC TAA GAA A | Quencher-1 | WT Probe | ||
| 53370 | Fluorophore-2 | AAT GTG AAT GAG GGT TTT GTC TGT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 51530 | 0.50 uM |
| 51531 | 0.50 uM |
| 51532 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.