For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:25798358+25798453 96bp GGCTTGGTGAGCTTATAATGA TGGTGTACCTAAAAGCACAAAGTC
Mut = 92 bp
Wt = 96 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GGGAATATTCTAGGCTTGGTGAGCTTATAATGACAGCATGAgtggggtgtggtctggagcgttgccgtctaaacctgtgttgatgactttgtgcttttaggtacaccaagcttggctacgcaggcaacactgaaccacagttcattatcccgtcatgtaagtaaagctctcccttgggttctcaaggcttgtgtccctcagctttgaaagcagcccggttctgtgtatcaggtgtcataatggttttagtggcatcttgtagaccatcacccacttcctgggaagggctgcttactctgagcattgctaTGGGAGGTGACTGTCACCTGGACTTCATTAGCAGCATGCTTGTTCTTGAGCCCTTCAAACTCCTTTCTTTGTCATTGGCTTTCTAGTTTCACCTCCGGAGGCTACCA
This mutation is a 268 bp deletion beginning at Chromosome 5 position 25,798,387 bp and ending after 25,798,654 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53263 | GGC TTG GTG AGC TTA TAA TGA | Common | A | |||
| 53264 | TGG TGT ACC TAA AAG CAC AAA GTC | Wild type Reverse | A | |||
| 53265 | GGA GTT TGA AGG GCT CAA GA | Mutant Reverse | A | |||
| 53266 | Fluorophore-1 | CTG GAG CGT TGC CGT CTA A | Quencher-1 | WT Probe | ||
| 53267 | Fluorophore-2 | ATG GGA GGT GAC TGT CAC CTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 53263 | 0.40 uM |
| 53264 | 0.40 uM |
| 53265 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.