For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:102525315+102525429 115bp ATTAGGATTGGGCTCACAGC GGATTTCAAACTGGATCTGTCC
Mut = 99 bp
Wt = 115 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CAAGTGACTATTAGGATTGGGCTCACAGCCCTCCTCAGGGGTCCCCCACCCCACCCACCCCCcgtactgacttggtttccctgtgttaacagcctacccctgggacagatccagtttgaaatccatgcccctggacctccggctctttgaaaaactggatgcctctgcctcacaggtaggagaattgactcccttggctaaaggccccaaaggtgacttggagttccccaagtcaggataaaagagcctacctccaaggcctctcttgaTCATACACTGAGTAAACCAGATGGATGGTCTATGGCTGTCCTTTCACAGT
This mutation is a 207 bp deletion beginning at Chromosome 9 position 102,525,368 bp and ending after 102,525,574 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53035 | ATT AGG ATT GGG CTC ACA GC | Common | A | |||
| 53036 | GGA TTT CAA ACT GGA TCT GTC C | Wild type Reverse | A | |||
| 53037 | TGA AAG GAC AGC CAT AGA CCA | Mutant Reverse | A | |||
| 53038 | Fluorophore-1 | TTG GTT TCC CTG TGT TAA CAG C | Quencher-1 | WT Probe | ||
| 53039 | Fluorophore-2 | CCC CTC ATA CAC TGA GTA AAC CAG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 53035 | 0.40 uM |
| 53036 | 0.40 uM |
| 53037 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.