Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr9:114789286-114789396 111bp CCTTCTAGCCTTTATTTTTCTTACAC CCACACACACGAAACAAATG
Mut = 82 bp
Wt = 111 bp
Fam = Mut
Hex = Wt
Common primer anneals over the nucleotide sequence containing mouse genomic variation rs248217201.
MUT Sequence (junction in uppercase):
gtttttattatgtatattggggatatgtctacatgggtgggcatgtgtgtataatatgtacaggtTGagattacatttgtttcgtgtgtgtggatgtgtgtttgtgcatgggtgcgggggcgccaatgtgcc
This mutation is a 6990 bp deletion beginning at Chromosome 9 position 114,789,313 bp and ending after 114,796,302 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53026 | CCA CAC ACA CGA AAC AAA TG | Common | A | |||
| 53027 | CCT TCT AGC CTT TAT TTT TCT TAC AC | Wild type Forward | A | |||
| 53028 | GTA TAT TGG GGA TAT GTC TAC ATG G | Mutant Forward | A | |||
| 53029 | Fluorophore-1 | CGT GTG GAG TTT GTA AAG CCA | Quencher-1 | WT Probe | ||
| 53030 | Fluorophore-2 | TGG GCA TGT GTG TAT AAT ATG TAC AG | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 53026 | 0.40 uM |
| 53027 | 0.40 uM |
| 53028 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.