For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:105293849-105293939 91bp CAGACCTCAGTGTCCCTTGC ACTGTAGCCGGCACTAAGGA
Mut= 88 bp
Wt= 91 bp
Fam=Mut
Hex=Wt
Sequence
Mut Sequence:
ggccttagcctggatgttcagatgacccgacgcagtaccatgcttattattaaatagttaatacatcacaccagtctccagacctcagtgtcccttgctgtacccatagcccagtgcaattaggggtccgtgcacagtggtacatctataatcctggctgaatcctagtattctggcagcatctcacctatgcagacatctgctctctttgtggactgcgtgccccgaaccc
This mutation is a 4024 bp deletion beginning at Chromosome 8 position 105,289,880 bp and ending after 105,293,903 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53008 | CAG ACC TCA GTG TCC CTT GC | Common | A | |||
| 53009 | ACT GTA GCC GGC ACT AAG GA | Wild type Reverse | A | |||
| 53010 | AGG ATT CAG CCA GGA TTA TAG ATG | Mutant Reverse | A | |||
| 53011 | Fluorophore-1 | AGA CCT CAA GCC GTC TCC TT | Quencher-1 | WT Probe | ||
| 53012 | Fluorophore-2 | CCC AGT GCA ATT AGG GGT C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 53008 | 0.40 uM |
| 53009 | 0.40 uM |
| 53010 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.