Protocol 38067: Probe Assay - Cox7a2l<em1(IMPC)J>Alternate 1
Version 2.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr17:83513349-83513466 118bp TAATTCGGGGCAGCATTAAC GCTGAGCAGTGATTCAGTTCA

Mut = 120 bp

Wt = 118 bp

Fam = Mut

Hex = Wt

 

Sequence

MUT Sequence (junction in uppercase):

 

gaccccacccacgtcctgggcccgcccccgctctaggccccgcccagaactcgctctgaccgactgtgtcgctctcagccgcCCataggggactgagcttccctaaacctgagcgttgatttctttttaattagccaccaagccttttttttttttaattta

This mutation is a 12,878 bp deletion beginning at Chromosome 17 position 83,501,735 bp and ending after 83,514,612 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
51557 TAA TTC GGG GCA GCA TTA AC Wild type Forward A
51558 GCT GAG CAG TGA TTC AGT TCA Wild type Reverse A
51559 GAC CCC ACC CAC GTC CTG Mutant Forward A
51560 ATC AAC GCT CAG GTT TAG GG Mutant Reverse A
51561 Fluorophore-1 CGA GTG AGC AGA TTT TCT GGC A Quencher-1 WT Probe
52912 Fluorophore-2 AGA ACT CGC TCT GAC CGA CTG TG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
51557 0.40 uM
51558 0.40 uM
51559 0.40 uM
51560 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.