For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = T
Heterozygote = -/T
Wild type = -
Mutation is a T insertion.
Sequence
WT sequence showing the {insertion}:
ACTACCAACCAACTCCACAGAAATGGCCGGGGCCTCTGTGAAGGTGGCGGTGCGTGTCCGCCCCTT{t}CAACTCCCGGGAAATGAGCCGAGACTCCAAGTGCATCATTCAGATGTCTGGAAGCACCACCA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52892 | GGG GCC TCT GTG AAG GTG | Forward | A | |||
| 52893 | TTG GAG TCT CGG CTC ATT TC | Reverse | A | |||
| 52894 | Fluorophore-1 | CGC CCC TTC AAC TCC C | Quencher-1 | WT Probe | ||
| 52895 | Fluorophore-2 | CGC CCC TTT CAA CTC CC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52892 | 0.40 uM |
| 52893 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.