Protocol 38010: Probe Assay - Ociad1<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr5:73306840+73307003 164bp CACCTCTGCTACTGTCTGCTG CAAACTAACAAGAAGCCCAAACTG

Mut= 173 bp

Wt= 164 bp

Fam=Mut

Hex=Wt

Sequence

Mut Sequence:

catgtttatgaaacctgatctgaaggaggcttttctttgtgagagacacctacccccaaagctaaatatttagaaaatggaatgtatgtttggaaactgaagttttagcttaagatgttattatgttaatatgtctaactcttcaagatatttaccaaagtaaattatttttagaagaatagtcacttaagagtgggtgagatgactcagcaggtagagccact

This mutation is a 4204 bp deletion beginning at Chromosome 5 position 73,306,259 bp and ending after 73,310,462 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
52757 CAC CTC TGC TAC TGT CTG CTG Wild type Forward A
52758 CAA ACT AAC AAG AAG CCC AAA CTG Wild type Reverse A
52759 GGA GGC TTT TCT TTG TGA GAG Mutant Forward A
52760 CCC ACT CTT AAG TGA CTA TTC TTC Mutant Reverse A
52761 Fluorophore-1 AAA GAT GGG CAA GGC CTG Quencher-1 WT Probe
52762 Fluorophore-2 AGA CAC CTA CCC CCA AAG CTA AA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
52757 0.40 uM
52758 0.40 uM
52759 0.40 uM
52760 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.