For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr18:35650235-35650370 136bp CATGGTGGCCGAAATGAC TCAGGTGCTGGGATTAACG
Mut= 142 bp
Wt= 136 bp
Fam=Mut
Hex=Wt
Sequence
Mut Sequence:
gctgctgcctccttactaaataaagcctgccttcctctcacatgcctgtcggccggagtccggagccccacctccacgctgcacctgtgttggagaaagttcggcatgggggcttcacccctaaaagcccacagcttaggtttctctgctgccaaggccgctagctcaggcgttgacgctggcgctttaagacgctttttaaaacaaaacaagacaaaatttaaaaaaaatcacttataccttgcatgatggtatacaccgttaatcccagcacctgagaggcagaagcaggtggatctctttgagttcaaggacagtcgaggctgtctcaaaaagtcaagtaaataacatttaaaat
This mutation is a 4975 bp deletion beginning at Chromosome 18 position 35,650,319 bp and ending after 35,655,293 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52631 | CAT GGT GGC CGA AAT GAC | Wild type Forward | A | |||
| 52632 | TCA GGT GCT GGG ATT AAC G | Common | A | |||
| 52633 | TAG GTT TCT CTG CTG CCA AG | Mutant Forward | A | |||
| 52634 | Fluorophore-1 | AGT CCT AAT TTC CTG CTG CCA C | Quencher-1 | WT Probe | ||
| 52635 | Fluorophore-2 | CTG GCG CTT TAA GAC GCT TT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52631 | 0.40 uM |
| 52632 | 0.40 uM |
| 52633 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.