For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:76239286-76239431 146bp AGTGGGAATTAGATCTTCTGAAAGG TGTTAAAGGCAGACAGGAATCT
Mut= 161 bp
Wt= 146 bp
Fam=Mut
Hex=Wt
Sequence
Mut Sequence
gttctgatcaccgggggttcatgaacatacacagacactcaggcatacacatataaacacataaataaataaatatgtaaaaagagaacctggaaccgctcagcccagacccagacctccagtaacactaggacactcaaggaccttggtgttgacccttaagactgaaaggaaagtaatatggggttgcatttatactttcttctggggtataaagagctctctaaactattgtacgcacattatcaatttacatttgaatttttgtggtttggttgtttcttaagtactatagatagcatttatgatagttgaaaacttttgaatgaGGagtttagattcctgtctgcctttaacactcctactgaagatggtgcctcattcagtgcttttagaagtcagaatattgctaacggaataccatgctcaaaatttatgacacaggggccagagagttggctctgcagttaagagctttgagtgtgcttccagaggaccaaggtttaattcctaacatccacatggtagctctgcaactccagttccagaggatctgatgccctgttctgctctctgcaggcatcaggcacacagacatagatgcagaccaaacacccacatgcataaaatttttaaaaagttaaagtaaaaaaatattgtggcataataataactataagcat
This mutation is a 6247 bp deletion beginning at Chromosome 12 position 76,239,314 bp and ending after 76,245,560 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52516 | AGT GGG AAT TAG ATC TTC TGA AAG G | Wild type Forward | A | |||
| 52517 | TGT TAA AGG CAG ACA GGA ATC T | Common | A | |||
| 52518 | CTT TCT TCT GGG GTA TAA AGA GC | Mutant Forward | A | |||
| 52519 | Fluorophore-1 | AGG GAG TTC TGC TAA CGG TTA G | Quencher-1 | |||
| 52520 | Fluorophore-2 | ATA GTT GAA AAC TTT TGA ATG AGG AGT | Quencher-2 |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52516 | 0.40 uM |
| 52517 | 0.40 uM |
| 52518 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.