For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:86988091-86988183 93bp TCCTGCCCACTTCAATCAG AAACTTGGGGTTGGGCTAGG
Mut= 97 bp
Wt= 93 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower casen):
CCTCCCTGTACCTCTCCAGACTCCAAGACAACAAGGACTTAGCCAAATGCAGTAGGTCTAGCCAGATGCTGACCAACTGTGGTCTCTGGGTCTCTAACCTGCTTGGTTCCAAACTAGGGAAACTGGAAAGGGTGATCCAAGGGGCAGGGTTTGGGAGATTTGTGTCCAGCCCTTCgaaccttggacaatgctgtaaggcttcctctctccttgtgccccttaggaatgtgatccaggatgctggccttgcggctgctcaacgtggtagcccccgcctactttctttgcatttccctggtgaccttcgtactgcagctcttcctcttcctgcccagcatgcgtgaggaccccacagccaccccgctcttctcgcctgctgtgcttcacggggcgctcttcctgttcctctcagccaatgccctgggcaattacgtcctggtcatccagaactccccagacgacctgggcacctgccaggggaccatgtcccagagacctcagtgcccaccgcccagcacccacttctgccgagtgtgttcccgagtcacgctgaggcacgaccatcactgtttcttcaccggcaactgcatcggcagcagaaacatgcgcaacttcatcctgttctgcctctacacctctctggcctgcctttactccatggtggctggagtggcctacatctcagctgtcctttccatctccttcgcccaccccctggccttccttacgctcctgcccacttcaatcagccagttcttctccggtgagtgggccatggcaggCAGGTTCAGCAAACAAGACCTCCTAGCCCAACCCCAAGTTTTTCAAATAAAAACCACAGGATGCTGGACTCAAACAGTCAGATAGACAGTTGTTTGGTATGACTATGTTCCAGTATTCCAGGAGGCATACTAAGAGAACAGATTATAATCTATCAGCAATTAGGATGAACTGGGCA
Thsi mutation is a 607 bp deletion beginning at Chromosome 12 position 86,988,132 bp and ending after 86,988,738 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52511 | TCC TGC CCA CTT CAA TCA G | Wild type Forward | A | |||
| 52512 | AAA CTT GGG GTT GGG CTA GG | Common | A | |||
| 52513 | AAA CTG GAA AGG GTG ATC CA | Mutant Forward | A | |||
| 52514 | Fluorophore-1 | CCA GTT CTT CTC CGG TGA GTG | Quencher-1 | WT Probe | ||
| 52515 | Fluorophore-2 | CCA GCC CTT CCA GGT TCA G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52511 | 0.40 uM |
| 52512 | 0.40 uM |
| 52513 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.