For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:25201236+25201339 104bp GCTTCATCCGAGAGTTCTTACA CACTTGGCCACCTGTTTCCT
Mut = 80 bp
Wt = 104 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GGTAGTGTTAGTGAGGTGACAGACCAAGTGGCTCTGGAGCCATGGATTCTGCTGGCTTGCCCCACCTCCGGGAACCctcgggctataactgctgtactgtgctgttggttgcagggagcttcaggctcaggaagccctgcagaatggccagctcagtggaggggatggtgtacctgatctgcagcctggggtcttggccagccaggccatgatcgagaagattcttggtgaggaccctcggtggcaaggtaagcctggggttgctggagtccttgcaggggcgagccatggcttttctccaggtacctgcttcatccgagagttcttacactagagaagaggacagatgggaaagtcaggtttctcagcccactgCTAACCGTGAGCCATTTAGGAAACAGGTGGCCAAGTGGGATTGGAACCTAGCCGCCT
This mutation is a 299 bp deletion beginning at Chromosome 17 position 25,201,004 bp and ending after 25,201,302 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52397 | CAC TTG GCC ACC TGT TTC CT | Common | A | |||
| 52398 | GCT TCA TCC GAG AGT TCT TAC A | Wild type Forward | A | |||
| 52399 | CTG GAG CCA TGG ATT CTG CT | Mutant Forward | A | |||
| 52400 | Fluorophore-1 | AGA AGA GGA CAG ATG GGA AAG TCA | Quencher-1 | WT Probe | ||
| 52401 | Fluorophore-2 | CAC CTC CGG GAA CCC TAA C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52397 | 0.40 uM |
| 52398 | 0.40 uM |
| 52399 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.