For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chrX:126815418-126815523 106bp GAGTATATTTGAAGAGGTTTCTGACTC TTCATTCTGAAGGCAAAGCA
Mut = 119 bp
Wt = 106 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AAGTTGAGTATATTTGAAGAGGTTTCTGACTCAGTAACAGTTCAAATTATGAGCTCTGTCTTacttagtgaggactcagacaggaacctcatgctttgccttcagaatgaagctaatgaaatggaaaatcctactgaacctctgaataagaggccttgtttgtcctctgaagttgattctacttcgtatatgtcagctcttgaattcccactacaagaaatggagcaaagttttggtttggtcacaaccacagccacagaggtggctgaggaagagtttggtggggaaaatatgatgcaattcgaggttttaaaagatgacaaacaatatgaagttttccccttgcctaacaaggaagagtcagtagttagccaagcatggttcacaagtaaggaagctaaggatgctctaactcatcaaggacagaaatggaagcaggggatgtggtccaaggaagaaacagctattctgatgaacaacattgaaaggtatatgaaggaccatggagtagagaatcctgcagaaatcatttttaagatggcaaaaggtaaaagaaaagatttctacaggtctgtatcattgggtctgaatagacctttgttttcagtttatagaagagtggtccgaatgtatgatgacagaaaccatgtgggtaagtacagccctgaggaaatagagaagctcaaggagctctggcagaagcatggcaatgactggataacaataggggccgccatgggaagaagtccatcttcggtcaaagaccggtgccgactgatgaaggatacttgcaacacggggaaatggaccgaagaagaagaacagcttcttggcgatgtggttcatgaattgacatgcactgaggtggatgagaaagttacccatggtgtgtgttgggcaacagtggctcaacgagtgggtactcgctcagcaaagcagtgtcgtgctaaatggctcaactacttgaactggaaacagactggtggtattgagtggacaaggaaagatgaagtcactctcatccaaaggctagtagagcttgatgtatccgatgaaagtgaaattcgctgggatgaattagctaaaggatgggaaagtgttcgttcaccacaatggctgcgaaataaatggtggatcatcaaaaggcaaattacaaatcataaagattttgcattcccagtcctagtaagatgtcttcaacaagaatatgaaagccaaaatgccagcctcaggttttgggagaataaatcaggatctgaagtaccagatagcaaccctgatatcatttttcaacaagtcccctttggagtcacaagtatagaaaataataatgcatccatctgtactgaccccatgacaggattgcaaatttcattccagctcatccccagacccacaacagaattacctgatgctgttgttgactctgaaaccataaccctgcccaCTGGACCACAGTAGATATGTGAGAATCTCCCTTCTTTCCTTATGTGTTCCACTCCCTTACCTTAAACCTATTTCCTTCA
This mutation is a 1381 bp deletion beginning at Chromosome X position 126,814,082 bp and ending after 126,815,466 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52313 | GAG TAT ATT TGA AGA GGT TTC TGA CTC | Common | A | |||
| 52314 | TTC ATT CTG AAG GCA AAG CA | Wild type Reverse | A | |||
| 52315 | AAG GGA GTG GAA CAC ATA AGG A | Mutant Reverse | A | |||
| 52316 | Fluorophore-1 | CTT AGT GAG GAC TCA GAC AGG AAC C | Quencher-1 | WT Probe | ||
| 52317 | Fluorophore-2 | CTT TGG TCT GGA CCA CAG TAG ATA TG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52313 | 0.40 uM |
| 52314 | 0.40 uM |
| 52315 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.