For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr16:31944211+31944328 118bp AAGCTTGGAACTGGCTCACC AGTGGGAAGACCACAGTGC
Mut = 110 bp
Wt = 118 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CCCAGAACGCGAGCCTGCGCAAGCCTAAGCTTGGAACTGGCTCACCCCTGCCTCTCTCTCTGCAGAGGACATCCTGGgtgtgcaggctacacggccctgggaattttaccccagcagctcctgccgcactgtggtcttcccactgctgacctctggctctaccttctggttactcaggctctgggaagagctggggctctggcctggtctggtgagtggctacatgctgctggtggggccccgattccttctcaccgccctctcctttgccctggactgggctgtgtacgatctggccccgttgtggggggcagatcgttggaatgccttgtgcctgctgtctggttcctatgtcaccctggttttctacacaagaaccttctccaacaccatcgagggactgctcttcacctggctgctggtgctggtgtcccctggtgtggtaaggagtcctacatcaaagaagcctaccccaggtccacggtggcacagatatcttcttggtgttatcttggctgctggcttcttcaaccggccaacctttctagcctttgctctggcccccctctctctctggggcatccatagagcttcagaacttggtggcatcagggccctgatccaggaggccctggtgctgttgccaggggctgctcttgctgcagtgctgtgtgtagccacggacagctggtacttctccagcctctcgagatccacaggcgtctttctcacacctgccaacttcttgtactacaacctggacccccaaaaccttgccaggcacggcacacacgcacggctcactcacttggcagtcaatggcttcctgctctttggggtgttgcatgctcaagctctgcaggctgcatggcaacaactccacgcctgcctccgtgcatccccacaaacgggtctctccagggtgcggggtgcccggggtctgttgtctagctccaagtcttatctcctcctcttctactttacacccctgctcctgctttctgccttcagccatcaagaggctagatttctgattcccctcctagtccctctagtcctgctgtgcagtccacaaacccaacctataccctggaaaggcaccctggtcctcttcaacatcctgggcgctctcatctttggttgcctgcatcagggaggtctggtaccgggcctgaagtacctggagcagatagtccacacgcctgacctctcaggcacgaccacccactacacacttctcttcacacacacctacatgcctccccagcacctcttacacctctcaggcctgggatcacccgtggaggtggtagacatgggtggggctgaggacagggtcctgtgtcaagccctgaacaacttcagcagacaacctgcctgccaactggctggtgagccatggccctgtcggctctttgtggtaactcctgggaccaacaggcacgctctggagaagtgccgttttcccctcaagaatgagactctcttgtttccccacttgaccctggaggaccctccagccctgtcctctctgctcagtggggcttggaggaagcaccttagtctccatgtcatagaactggagacgcctgttgtgACAAAGCAGCCCAAGGCTCAGCCATAGAAGCCATTCCACCTTCTACACAGGCTGCTGGGCTGGGACATTGGA
This mutation is a 1520 bp deletion beginning at Chromosome 16 position 31,944,262 bp and ending after 31,945,781 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52306 | AAG CTT GGA ACT GGC TCA CC | Common | A | |||
| 52307 | AGT GGG AAG ACC ACA GTG C | Wild type Reverse | A | |||
| 52308 | CCC AGC AGC CTG TGT AGA AG | Mutant Reverse | A | |||
| 52309 | Fluorophore-1 | CCT GGG AAT TTT ACC CCA GC | Quencher-1 | WT Probe | ||
| 52310 | Fluorophore-2 | CCT GGA CAA AGC AGC CCA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52306 | 0.40 uM |
| 52307 | 0.40 uM |
| 52308 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.