For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:34905318-34905417 100bp TCTCTCCTGGATGGGGAACT CTGTGGGGACCAGTCCTTCT
Mut = 105 bp
Wt = 100 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
ATTATTAGCTGTCGCTCTTTCATTTGCCCACCCTTTGATGAGCAGAAATGGTTTGGATGTGGCGTGTCTAGGAAGCTCCCTCaacagagggaaggtcctgtgatgtcactggctcactgggctttgcccctccatagctttttgcactgcaagctgaaatccatcgactaaagaaggaagagcagcagcaggaagaagaagcagcagctttggtccagcataagctgccgccttatgtttccagtatggaccgccttggggactcggagctgtgagtaggcttggggttcgagaggggtgggggctgccatatgtgtgaggtcccaattttttaaggttctctcctggatggggaactgtatagctagctgtgtcaggtatcatgataacggagtccagggaagctgcttcATAGGTGAGAAGGACTGGTCCCCACAGGTGGACATGTTCCTCAGGAGAAGCTGCTGGGGTTATAAAGAGGTAGACAGTATGGGAGAGAAGTTT
This mutation is a 329 bp deletion beginning at Chromosome 6 position 34,905,345 bp and ending after 34,905,673 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52299 | CTG TGG GGA CCA GTC CTT CT | Common | A | |||
| 52300 | TCT CTC CTG GAT GGG GAA CT | Wild type Forward | A | |||
| 52301 | TTA GCT GTC GCT CTT TCA TTT G | Mutant Forward | A | |||
| 52302 | Fluorophore-1 | ATG ATA ACG GAG TCC AGG GAA G | Quencher-1 | WT Probe | ||
| 52303 | Fluorophore-2 | CGT GTC TAG GAA GCT CCC TCA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52299 | 0.40 uM |
| 52300 | 0.40 uM |
| 52301 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.