Protocol 37794: Probe Assay - Tchh<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr3:93445233+93445363 131bp AGGAGCGAGAGAGACGTCAG TCGCTGAAACTGCTCTTCC

Mut = 119 bp

Wt = 131 bp

Fam = Mut

Hex = Wt

 

Sequence

MUT Sequence (junction in uppercase):

ggctaaaccatctctccagctcctctgtgcattttctaatcgctccaaatagtcccctccCAGActcatatatagtctggaaattcatgtattcccaatatcttatggtagttttactattagctatgtccaaataagaaaggaaga

 

This mutation is a 5805 bp deletion beginning at Chromosome 3 position 93,443,307 bp and ending after 93,449,111 bp (GRCm38/mm10). There is a 2 bp insertion (AG) at the deletion site.

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
52168 AGG AGC GAG AGA GAC GTC AG Wild type Forward A
52170 TCG CTG AAA CTG CTC TTC C Wild type Reverse A
52171 TGC ATT TTC TAA TCG CTC CA Mutant Forward A
52172 CTT CCT TTC TTA TTT GGA CAT AGC Mutant Reverse A
52173 Fluorophore-1 AGG AAG AGA AGA GAG AGC TGG AGC Quencher-1 WT Probe
52174 Fluorophore-2 CCC TCC CAG ACT CAT ATA TAG TCT GGA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
52168 0.40 uM
52170 0.40 uM
52171 0.40 uM
52172 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.